Ferrienterochelin and colicins
WebOuter membrane receptor for ferrienterochelin and colicins [Inorganic ion transport and metabolism] Links? Taxonomy: Proteobacteria: Statistics? Accession: cl34814: PSSM Id: 361690: Name: FepA: Created: 19-Sep-2024: Updated: … WebMap location of the cbr gene coding for production of the outer membrane receptor for ferrienterochelin and colicins B and D in Escherichia coli K-12 Anthony P. Pugsley Pages 275-277
Ferrienterochelin and colicins
Did you know?
WebK12689 capA; campylobacter adhesion protein K19231 bmaC; fibronectin-binding autotransporter adhesin K16081 algE; alginate production protein K19611 fepA, pfeA, iroN, pirA; ferric enterobactin receptor K16090 fiu; catecholate siderophore receptor K16091 fecA; Fe(3+) dicitrate transport protein K16092 btuB; vitamin B12 transporter K21573 susC ... WebOnly the outer membrane receptor for ferrienterochelin and colicins (K16089) was enriched in HSFA-W (Supplementary Figure 2A). For men, there were differences in four pathways (response regulator ...
WebSep 1, 1986 · membrane receptor for ferrienterochelin and colicins . B and . D. The predicted FepA polypeptide has a molec- ular weight of 79,908 and consists of 723 amino acids. WebSep 26, 2024 · Gene clusters similar to known bacteriocins have been described in other Aeromonas genomes , and the receptor for ferrienterochelin and colicins was identified in A. salmonicida subsp. pectinolytica 34melT genome . However, no correlation between the presence of these clusters and bacteriocin activity has been reported until now.
WebAug 15, 1986 · We have determined the nucleotide sequence of the Escherichia coli fepA gene, which codes for the outer membrane receptor for ferrienterochelin and colicins … WebBXY_11110 Outer membrane receptor for ferrienterochelin and colicins [] Gene ID: 15191501, discontinued on 20-May-2015. Summary. Gene provides a unified query …
WebViewers. Legend. Settings
WebKEGG Orthology (KO) [BR:ko00001] 09180 Brite Hierarchies 09183 Protein families: signaling and cellular processes 02000 Transporters K16089 TC.FEV.OM2, cirA, cfrA, hmuR; outer membrane receptor for ferrienterochelin and colicins butcher pete part 1 and 2WebNE1540* FepA, outer membrane receptor for ferrienterochelin and colicins NE1089* FhuA, ferrichrome receptor, also homologous to FhuE, outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid NE1531* CirA, outer membrane receptor proteins mostly for Fe transport NE1205* CirA, outer membrane receptor proteins mostly for Fe … cctb bragaWebLocus tag: blr4504 Name: fhuA1 Funciton: Outer membrane receptor for ferrienterochelin and colicins blr4504. fhuA1. Outer membrane receptor for ferrienterochelin and colicins. Position: -62 Score: 4.6 Sequence: AGCTTAGAACGCTTCTATGCC Locus tag: bll5796 Name: fumA Funciton: Fumarate hydratase class I, aerobic (EC 4.2.1.2) bll5796. fumA ... cct bâtiment togoA colicin is a type of bacteriocin produced by and toxic to some strains of Escherichia coli. Colicins are released into the environment to reduce competition from other bacterial strains. Colicins bind to outer membrane receptors, using them to translocate to the cytoplasm or cytoplasmic membrane, where … See more Channel-forming colicins (colicins A, B, E1, Ia, Ib, and N) are transmembrane proteins that depolarize the cytoplasmic membrane, leading to dissipation of cellular energy. These colicins contain at least three … See more Most colicins are able to translocate the outer membrane by a two-receptor system, where one receptor is used for the initial binding and the second for translocation. The … See more Virtually all colicins are carried on plasmids. The two general classes of colicinogenic plasmids are large, low-copy-number plasmids, and small, high-copy-number plasmids. The larger plasmids carry other genes, as well as the colicin operon. The colicin operons are … See more Because they target specific receptors and use specific translocation machinery, cells can make themselves resistant to the colicin by repressing or deleting the genes for these proteins. … See more • Molecular mechanisms of colicin evolution pdf • The newly characterized colicin Y provides evidence of positive selection in pore-former colicin diversification • Colicin OPM database See more butcher pete part 2WebTonB-dependent receptor%3B Outer membrane receptor for ferrienterochelin and colicins;Note=TonB-dependent receptor%3B Outer membrane receptor for ferrienterochelin and colicinsAFTF01000225.1: 51 ... cct bawüWebBXY_10960 Outer membrane receptor for ferrienterochelin and colicins [] Gene ID: 15191488, discontinued on 20-May-2015. Summary. Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. BXY_10960 Outer membrane receptor for ferrienterochelin and colicins [] Gene ID: 15191488 ... cct baton rougeWebFeb 1, 1979 · The Escherichia coli gene for the ferrienterochelin uptake and colicins B and D receptor protein is located at approximately 13 min, adjacent to or among genes for … cct battery